Review



sgrna expressing vector cloning  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc sgrna expressing vector cloning
    Sgrna Expressing Vector Cloning, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 242 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+into+sgrna+ms2+cloning+backbone+vector/sgRNA(MS2)+cloning+backbone+(Plasmid+%2361424)/pm40315428-287-2-7
    Average 95 stars, based on 242 article reviews
    sgrna expressing vector cloning - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Cloning:

    Article Title: Transcriptomic signatures of cold acclimated adipocytes reveal CXCL12 as a Brown autocrine and paracrine chemokine
    Article Snippet: .. sgRNA design and cloning into sgRNA (MS2) cloning backbone vector (Addgene, #61424) for gain-of-function in WT-1-SAM cells was performed as previously described [ ]. .. For Cxcl12 over-expression experiments, WT-1-SAM cells were reverse-transfected on d.4 after induction of differentiation with 500 ng of Cxcl12 sgRNA plasmid DNA (sgRNA sequence: TCTCTGACGCGCATCCCCTG) using TransIT-X2 (Mirus Bio, Cat. MIR6000).

    Article Title: Transcriptomic signatures of cold acclimated adipocytes reveal CXCL12 as a Brown autocrine and paracrine chemokine.
    Article Snippet: .. CRISPRa-SAM mediated gain-of-function in WT-1-SAM cells 224 sgRNA design and cloning into sgRNA (MS2) cloning backbone vector (Addgene, #61424) for 225 gain-of-function in WT-1-SAM cells was performed as previously described40. .. For Cxcl12 over-226 expression experiments, WT-1-SAM cells were reverse-transfected on d.4 after induction of 227 differentiation with 500 ng of Cxcl12 sgRNA plasmid DNA (sgRNA sequence: 228 TCTCTGACGCGCATCCCCTG) using TransIT-X2 (Mirus Bio, Cat. MIR6000).

    Plasmid Preparation:

    Article Title: Transcriptomic signatures of cold acclimated adipocytes reveal CXCL12 as a Brown autocrine and paracrine chemokine
    Article Snippet: .. sgRNA design and cloning into sgRNA (MS2) cloning backbone vector (Addgene, #61424) for gain-of-function in WT-1-SAM cells was performed as previously described [ ]. .. For Cxcl12 over-expression experiments, WT-1-SAM cells were reverse-transfected on d.4 after induction of differentiation with 500 ng of Cxcl12 sgRNA plasmid DNA (sgRNA sequence: TCTCTGACGCGCATCCCCTG) using TransIT-X2 (Mirus Bio, Cat. MIR6000).



    Similar Products

    sgrna expressing vector cloning  (Addgene inc)
    95
    Addgene inc sgrna expressing vector cloning
    Sgrna Expressing Vector Cloning, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+into+sgrna+ms2+cloning+backbone+vector/sgRNA(MS2)+cloning+backbone+(Plasmid+%2361424)/pm40315428-287-2-7
    Average 95 stars, based on 1 article reviews
    sgrna expressing vector cloning - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    cloning into sgrna ms2 cloning backbone vector  (Addgene inc)
    95
    Addgene inc cloning into sgrna ms2 cloning backbone vector
    Cloning Into Sgrna Ms2 Cloning Backbone Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+into+sgrna+ms2+cloning+backbone+vector/sgRNA(MS2)+cloning+backbone+(Plasmid+%2361424)/pmc11841078-94-3-10
    Average 95 stars, based on 1 article reviews
    cloning into sgrna ms2 cloning backbone vector - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    guide rna sgrna expression vectors  (Addgene inc)
    95
    Addgene inc guide rna sgrna expression vectors
    Guide Rna Sgrna Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+into+sgrna+ms2+cloning+backbone+vector/sgRNA(MS2)+cloning+backbone+(Plasmid+%2361424)/pmc11567901-358-2-27
    Average 95 stars, based on 1 article reviews
    guide rna sgrna expression vectors - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    sgrna ms2 vector  (Addgene inc)
    95
    Addgene inc sgrna ms2 vector
    A – C The glutamine, GSH/GSSG ratio, and ROS detected by CellROX Deep Red Reagent staining in cell subclones, respectively. D , E Cells transfected with si-Scramble or si-SLC1A5. D The GSH/GSSG ratio. Cells treated without or with 6.9 µM cisplatin for 24 hour (let panels) or 48 hours (right panels). E Confocal microscopy to illustrate the C11-BODIPY-581/591 labeled polyunsaturated fatty acids in cells after 24 hours si-RNA transfection. F Illustration of SLC1A5 promoter region, the <t>sgRNA</t> targeting site, and western blot analysis. The transfection of <t>SLC1A5-MS2-vector</t> in OECM1-dCas9-SAM cell subclone upregulates SLC1A5 expression. Numbers designate the normalized expression value. G The GSH/GSSG ratio in cells transfected with VA or SLC1A5 plasmids, without (upper) or with (lower) the 6.9 µM cisplatin treatment. H Confocal microscopy to detect the staining of C11-BODIPY-581/591. In ( E ) and ( H ), Lt panels, reduced form ; Middle panels, oxidized form (green); Rt panels, merged images. VA, vector alone. Mann-Whitney test. ** and ****, P < 0.01 and P < 0.0001, respectively.
    Sgrna Ms2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+into+sgrna+ms2+cloning+backbone+vector/sgRNA(MS2)+cloning+backbone+(Plasmid+%2361424)/pmc11369192-273-26-31
    Average 95 stars, based on 1 article reviews
    sgrna ms2 vector - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    sgrna vectors  (Addgene inc)
    95
    Addgene inc sgrna vectors
    A – C The glutamine, GSH/GSSG ratio, and ROS detected by CellROX Deep Red Reagent staining in cell subclones, respectively. D , E Cells transfected with si-Scramble or si-SLC1A5. D The GSH/GSSG ratio. Cells treated without or with 6.9 µM cisplatin for 24 hour (let panels) or 48 hours (right panels). E Confocal microscopy to illustrate the C11-BODIPY-581/591 labeled polyunsaturated fatty acids in cells after 24 hours si-RNA transfection. F Illustration of SLC1A5 promoter region, the <t>sgRNA</t> targeting site, and western blot analysis. The transfection of <t>SLC1A5-MS2-vector</t> in OECM1-dCas9-SAM cell subclone upregulates SLC1A5 expression. Numbers designate the normalized expression value. G The GSH/GSSG ratio in cells transfected with VA or SLC1A5 plasmids, without (upper) or with (lower) the 6.9 µM cisplatin treatment. H Confocal microscopy to detect the staining of C11-BODIPY-581/591. In ( E ) and ( H ), Lt panels, reduced form ; Middle panels, oxidized form (green); Rt panels, merged images. VA, vector alone. Mann-Whitney test. ** and ****, P < 0.01 and P < 0.0001, respectively.
    Sgrna Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+into+sgrna+ms2+cloning+backbone+vector/sgRNA(MS2)+cloning+backbone+(Plasmid+%2361424)/pmc11099189-308-1-14
    Average 95 stars, based on 1 article reviews
    sgrna vectors - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    plasmids sgrna expression vectors  (Addgene inc)
    95
    Addgene inc plasmids sgrna expression vectors
    A – C The glutamine, GSH/GSSG ratio, and ROS detected by CellROX Deep Red Reagent staining in cell subclones, respectively. D , E Cells transfected with si-Scramble or si-SLC1A5. D The GSH/GSSG ratio. Cells treated without or with 6.9 µM cisplatin for 24 hour (let panels) or 48 hours (right panels). E Confocal microscopy to illustrate the C11-BODIPY-581/591 labeled polyunsaturated fatty acids in cells after 24 hours si-RNA transfection. F Illustration of SLC1A5 promoter region, the <t>sgRNA</t> targeting site, and western blot analysis. The transfection of <t>SLC1A5-MS2-vector</t> in OECM1-dCas9-SAM cell subclone upregulates SLC1A5 expression. Numbers designate the normalized expression value. G The GSH/GSSG ratio in cells transfected with VA or SLC1A5 plasmids, without (upper) or with (lower) the 6.9 µM cisplatin treatment. H Confocal microscopy to detect the staining of C11-BODIPY-581/591. In ( E ) and ( H ), Lt panels, reduced form ; Middle panels, oxidized form (green); Rt panels, merged images. VA, vector alone. Mann-Whitney test. ** and ****, P < 0.01 and P < 0.0001, respectively.
    Plasmids Sgrna Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+into+sgrna+ms2+cloning+backbone+vector/sgRNA(MS2)+cloning+backbone+(Plasmid+%2361424)/us11851652-683-0-16
    Average 95 stars, based on 1 article reviews
    plasmids sgrna expression vectors - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    generation lentiviral grna cloning backbone vector  (Addgene inc)
    93
    Addgene inc generation lentiviral grna cloning backbone vector
    A – C The glutamine, GSH/GSSG ratio, and ROS detected by CellROX Deep Red Reagent staining in cell subclones, respectively. D , E Cells transfected with si-Scramble or si-SLC1A5. D The GSH/GSSG ratio. Cells treated without or with 6.9 µM cisplatin for 24 hour (let panels) or 48 hours (right panels). E Confocal microscopy to illustrate the C11-BODIPY-581/591 labeled polyunsaturated fatty acids in cells after 24 hours si-RNA transfection. F Illustration of SLC1A5 promoter region, the <t>sgRNA</t> targeting site, and western blot analysis. The transfection of <t>SLC1A5-MS2-vector</t> in OECM1-dCas9-SAM cell subclone upregulates SLC1A5 expression. Numbers designate the normalized expression value. G The GSH/GSSG ratio in cells transfected with VA or SLC1A5 plasmids, without (upper) or with (lower) the 6.9 µM cisplatin treatment. H Confocal microscopy to detect the staining of C11-BODIPY-581/591. In ( E ) and ( H ), Lt panels, reduced form ; Middle panels, oxidized form (green); Rt panels, merged images. VA, vector alone. Mann-Whitney test. ** and ****, P < 0.01 and P < 0.0001, respectively.
    Generation Lentiviral Grna Cloning Backbone Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+into+sgrna+ms2+cloning+backbone+vector/lenti+sgRNA(MS2)_puro+backbone+(Plasmid+%2373795)/pm37830558-79-42-48
    Average 93 stars, based on 1 article reviews
    generation lentiviral grna cloning backbone vector - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    A – C The glutamine, GSH/GSSG ratio, and ROS detected by CellROX Deep Red Reagent staining in cell subclones, respectively. D , E Cells transfected with si-Scramble or si-SLC1A5. D The GSH/GSSG ratio. Cells treated without or with 6.9 µM cisplatin for 24 hour (let panels) or 48 hours (right panels). E Confocal microscopy to illustrate the C11-BODIPY-581/591 labeled polyunsaturated fatty acids in cells after 24 hours si-RNA transfection. F Illustration of SLC1A5 promoter region, the sgRNA targeting site, and western blot analysis. The transfection of SLC1A5-MS2-vector in OECM1-dCas9-SAM cell subclone upregulates SLC1A5 expression. Numbers designate the normalized expression value. G The GSH/GSSG ratio in cells transfected with VA or SLC1A5 plasmids, without (upper) or with (lower) the 6.9 µM cisplatin treatment. H Confocal microscopy to detect the staining of C11-BODIPY-581/591. In ( E ) and ( H ), Lt panels, reduced form ; Middle panels, oxidized form (green); Rt panels, merged images. VA, vector alone. Mann-Whitney test. ** and ****, P < 0.01 and P < 0.0001, respectively.

    Journal: Cell Death Discovery

    Article Title: The disruption of NEAT1-miR-125b-5p-SLC1A5 cascade defines the oncogenicity and differential immune profile in head and neck squamous cell carcinoma

    doi: 10.1038/s41420-024-02158-1

    Figure Lengend Snippet: A – C The glutamine, GSH/GSSG ratio, and ROS detected by CellROX Deep Red Reagent staining in cell subclones, respectively. D , E Cells transfected with si-Scramble or si-SLC1A5. D The GSH/GSSG ratio. Cells treated without or with 6.9 µM cisplatin for 24 hour (let panels) or 48 hours (right panels). E Confocal microscopy to illustrate the C11-BODIPY-581/591 labeled polyunsaturated fatty acids in cells after 24 hours si-RNA transfection. F Illustration of SLC1A5 promoter region, the sgRNA targeting site, and western blot analysis. The transfection of SLC1A5-MS2-vector in OECM1-dCas9-SAM cell subclone upregulates SLC1A5 expression. Numbers designate the normalized expression value. G The GSH/GSSG ratio in cells transfected with VA or SLC1A5 plasmids, without (upper) or with (lower) the 6.9 µM cisplatin treatment. H Confocal microscopy to detect the staining of C11-BODIPY-581/591. In ( E ) and ( H ), Lt panels, reduced form ; Middle panels, oxidized form (green); Rt panels, merged images. VA, vector alone. Mann-Whitney test. ** and ****, P < 0.01 and P < 0.0001, respectively.

    Article Snippet: For endogenous SLC1A5 overexpression, the SLC1A5 activated sequence “SLC1A5-dCas9-SAM-S and SLC1A5-dCas9-SAM-AS” and the scramble sequence “NC-dCas9-SAM-S and NC-dCas9-SAM-AS” were mixed and annealed, then cloned into the sgRNA (MS2) vector (# 61424, Addgene, Watertown, MA, USA) to generate SLC1A5 promoter target gRNA (SLC1A5-gRNA) and scramble gRNA (scr-gRNA) expression vector [ ].

    Techniques: Staining, Transfection, Confocal Microscopy, Labeling, Western Blot, Plasmid Preparation, Expressing, MANN-WHITNEY